Transcript: Human NM_152707.4

Homo sapiens solute carrier family 25 member 16 (SLC25A16), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SLC25A16 (8034)
Length:
6581
CDS:
149..1147

Additional Resources:

NCBI RefSeq record:
NM_152707.4
NBCI Gene record:
SLC25A16 (8034)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152707.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044626 GCAATGATGATTCGAATCTTT pLKO.1 440 CDS 100% 5.625 7.875 N SLC25A16 n/a
2 TRCN0000229428 GGAACTGTTCTGCCGGAATTT pLKO_005 959 CDS 100% 13.200 10.560 N SLC25A16 n/a
3 TRCN0000229426 TGCTCCATTGGATCGAGTAAA pLKO_005 310 CDS 100% 13.200 10.560 N SLC25A16 n/a
4 TRCN0000044624 CCTTGGATTGTATAAAGGAAA pLKO.1 415 CDS 100% 4.950 3.960 N SLC25A16 n/a
5 TRCN0000044623 GCAGACAATATCCTACCCATT pLKO.1 910 CDS 100% 4.050 3.240 N SLC25A16 n/a
6 TRCN0000044627 GTTGCTCCATTGGATCGAGTA pLKO.1 308 CDS 100% 4.050 3.240 N SLC25A16 n/a
7 TRCN0000218159 AGGTCATGTGCACAGATTAAT pLKO_005 532 CDS 100% 15.000 10.500 N SLC25A16 n/a
8 TRCN0000229429 ATGCTGGCTAAACCGCTTTAA pLKO_005 1377 3UTR 100% 13.200 9.240 N SLC25A16 n/a
9 TRCN0000229427 TACAAGCATTTAGGAGTATTT pLKO_005 359 CDS 100% 13.200 9.240 N SLC25A16 n/a
10 TRCN0000044625 CGAATGCAATTAGGAACTGTT pLKO.1 947 CDS 100% 4.950 2.970 N SLC25A16 n/a
11 TRCN0000068580 CCTTGAAGAGTGTTGGGCTTT pLKO.1 783 CDS 100% 4.050 2.430 N Slc25a16 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 5543 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5544 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152707.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13987 pDONR223 98.5% 100% 100% None n/a
2 ccsbBroad304_13987 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479042 CTGCGGCATTCATGGACTTGGAGA pLX_317 41.8% 100% 100% V5 n/a
4 ccsbBroadEn_13988 pDONR223 100% 21.9% 15.1% None (many diffs) n/a
5 ccsbBroad304_13988 pLX_304 0% 21.9% 15.1% V5 (many diffs) n/a
6 TRCN0000473193 AACAAGGGTCAATACCAGACTGAT pLX_317 80% 21.9% 15.1% V5 (many diffs) n/a
Download CSV