Transcript: Mouse NM_152813.3

Mus musculus phospholipase C, delta 3 (Plcd3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Plcd3 (72469)
Length:
3031
CDS:
129..2486

Additional Resources:

NCBI RefSeq record:
NM_152813.3
NBCI Gene record:
Plcd3 (72469)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_152813.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097073 GAGGCTTATATTAGGGCCTTT pLKO.1 1218 CDS 100% 4.050 5.670 N Plcd3 n/a
2 TRCN0000097070 GCGCAGCTTCTAAGCACATAT pLKO.1 421 CDS 100% 13.200 10.560 N Plcd3 n/a
3 TRCN0000053686 GCGGATGAACTCAGCCAACTA pLKO.1 1886 CDS 100% 4.950 3.960 N PLCD3 n/a
4 TRCN0000097072 GCTTCCTCATAAACGGGCAAT pLKO.1 1996 CDS 100% 4.050 3.240 N Plcd3 n/a
5 TRCN0000443284 CTCTGGCAATCCAGGTGTTAA pLKO_005 2098 CDS 100% 13.200 9.240 N Plcd3 n/a
6 TRCN0000444394 GGTTTGTGGTAGAAGATTATG pLKO_005 2314 CDS 100% 13.200 9.240 N Plcd3 n/a
7 TRCN0000097071 CCAGCAGCTTATCCAGACTTA pLKO.1 992 CDS 100% 4.950 3.465 N Plcd3 n/a
8 TRCN0000097069 CGTAACCTTCATCCCTGAGAA pLKO.1 2787 3UTR 100% 4.950 3.465 N Plcd3 n/a
9 TRCN0000443042 AGATTCCCTGGTCAACTTGAG pLKO_005 2727 3UTR 100% 4.050 2.835 N Plcd3 n/a
10 TRCN0000053685 CGTGGACATGAACGACATGTA pLKO.1 761 CDS 100% 0.495 0.347 N PLCD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152813.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09384 pDONR223 100% 85.4% 88% None (many diffs) n/a
2 TRCN0000476382 GCCGCCGGCAGGTACTAGGAGAGC pLX_317 13.3% 85.4% 88% V5 (many diffs) n/a
Download CSV