Transcript: Human NM_152892.3

Homo sapiens leucine rich repeats and WD repeat domain containing 1 (LRWD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
LRWD1 (222229)
Length:
2160
CDS:
98..2041

Additional Resources:

NCBI RefSeq record:
NM_152892.3
NBCI Gene record:
LRWD1 (222229)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152892.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166622 CATCGTGCTCCACAAGTACAA pLKO.1 1084 CDS 100% 4.950 6.930 N LRWD1 n/a
2 TRCN0000166322 CTCCTATGACAAGCGGATCAT pLKO.1 1330 CDS 100% 4.950 6.930 N LRWD1 n/a
3 TRCN0000164857 CGTAAGGTCAATGGCAAGGAT pLKO.1 455 CDS 100% 3.000 4.200 N LRWD1 n/a
4 TRCN0000165805 CAAGGATGCGTCCTCAACTTA pLKO.1 469 CDS 100% 5.625 3.938 N LRWD1 n/a
5 TRCN0000165376 GATGGGCTGGCATTTGTGAAT pLKO.1 1598 CDS 100% 4.950 3.465 N LRWD1 n/a
6 TRCN0000165557 GACGGTCAATGACAACCTGAA pLKO.1 409 CDS 100% 4.050 2.835 N LRWD1 n/a
7 TRCN0000163291 GCATTTGTGAATGAGGACATC pLKO.1 1607 CDS 100% 4.050 2.835 N LRWD1 n/a
8 TRCN0000165963 GCTGGCATTTGTGAATGAGGA pLKO.1 1603 CDS 100% 2.640 1.848 N LRWD1 n/a
9 TRCN0000165119 CCTGAAAGTCTCCTTTCTCCT pLKO.1 424 CDS 100% 0.264 0.158 N LRWD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152892.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09878 pDONR223 100% 99.9% 93.3% None 1815G>A n/a
2 ccsbBroad304_09878 pLX_304 0% 99.9% 93.3% V5 (not translated due to prior stop codon) 1815G>A n/a
3 TRCN0000477736 TTAGAGAAAGGGAATACCTCACTG pLX_317 24.2% 99.9% 93.3% V5 (not translated due to prior stop codon) 1815G>A n/a
Download CSV