Transcript: Human NM_153000.5

Homo sapiens APC down-regulated 1 (APCDD1), mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
APCDD1 (147495)
Length:
3803
CDS:
348..1892

Additional Resources:

NCBI RefSeq record:
NM_153000.5
NBCI Gene record:
APCDD1 (147495)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153000.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136596 CGGTGCACAAATCCCACTTAT pLKO.1 687 CDS 100% 13.200 18.480 N APCDD1 n/a
2 TRCN0000421225 AGTTCTGGACGAGCGTGTTTG pLKO_005 2149 3UTR 100% 10.800 15.120 N APCDD1 n/a
3 TRCN0000420894 AGGCACCGAGTTCGTGTTCAA pLKO_005 1421 CDS 100% 4.950 6.930 N APCDD1 n/a
4 TRCN0000413419 GAAAGCTAGGGCCTCTTATTT pLKO_005 2181 3UTR 100% 15.000 10.500 N APCDD1 n/a
5 TRCN0000137317 GCCAGAGAACTGTCCTTCTTT pLKO.1 1993 3UTR 100% 5.625 3.938 N APCDD1 n/a
6 TRCN0000136710 GAGCTCTTCCTTGGTGACATT pLKO.1 1032 CDS 100% 4.950 3.465 N APCDD1 n/a
7 TRCN0000136748 GCTGGAATCCAATGCAGAGTT pLKO.1 2336 3UTR 100% 4.950 3.465 N APCDD1 n/a
8 TRCN0000122476 CATCCTGGCTAACACTGTGAA pLKO.1 3355 3UTR 100% 4.950 2.475 Y AARD n/a
9 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 3346 3UTR 100% 4.050 2.025 Y INTS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153000.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04996 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04996 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466919 CTCCATATCTTCTCTAGTATATTA pLX_317 25% 100% 100% V5 n/a
Download CSV