Transcript: Human NM_153026.3

Homo sapiens prickle planar cell polarity protein 1 (PRICKLE1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PRICKLE1 (144165)
Length:
5878
CDS:
331..2826

Additional Resources:

NCBI RefSeq record:
NM_153026.3
NBCI Gene record:
PRICKLE1 (144165)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017403 GCTCAGCATGTGACGAGATAA pLKO.1 902 CDS 100% 13.200 9.240 N PRICKLE1 n/a
2 TRCN0000342935 GCTCAGCATGTGACGAGATAA pLKO_005 902 CDS 100% 13.200 9.240 N PRICKLE1 n/a
3 TRCN0000017404 GCCCTGAATCTTGTTACAGAA pLKO.1 2386 CDS 100% 4.950 3.465 N PRICKLE1 n/a
4 TRCN0000352794 GCCCTGAATCTTGTTACAGAA pLKO_005 2386 CDS 100% 4.950 3.465 N PRICKLE1 n/a
5 TRCN0000017407 CAGAGCAAAGTGTTCGGGATT pLKO.1 1916 CDS 100% 4.050 2.835 N PRICKLE1 n/a
6 TRCN0000342936 CAGAGCAAAGTGTTCGGGATT pLKO_005 1916 CDS 100% 4.050 2.835 N PRICKLE1 n/a
7 TRCN0000017405 CCACCACATGATAATGAGGTA pLKO.1 559 CDS 100% 2.640 1.848 N PRICKLE1 n/a
8 TRCN0000017406 CCTACTATACAGATGACCTTT pLKO.1 2705 CDS 100% 4.950 2.970 N PRICKLE1 n/a
9 TRCN0000342937 CCTACTATACAGATGACCTTT pLKO_005 2705 CDS 100% 4.950 2.970 N PRICKLE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04968 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04968 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473091 TTACTACCAGTTTAATTAACAGAT pLX_317 17.6% 100% 100% V5 n/a
Download CSV