Transcript: Mouse NM_153133.2

Mus musculus retinol dehydrogenase 9 (Rdh9), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Rdh9 (103142)
Length:
2698
CDS:
81..1034

Additional Resources:

NCBI RefSeq record:
NM_153133.2
NBCI Gene record:
Rdh9 (103142)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041973 CCAGTGTCTTGGGCCGAGTAT pLKO.1 568 CDS 100% 1.650 1.155 N Rdh9 n/a
2 TRCN0000041975 CCCAACGAGTGGATGAAGAAA pLKO.1 441 CDS 100% 5.625 3.375 N Rdh9 n/a
3 TRCN0000041974 GCTTACTGCATCTCTAAGTAT pLKO.1 603 CDS 100% 5.625 3.375 N Rdh9 n/a
4 TRCN0000041976 ACTTCCCTGAAGCCTGAGAAA pLKO.1 1005 CDS 100% 4.950 2.970 N Rdh9 n/a
5 TRCN0000041943 CGCAGGAGAAACTTGTAAATA pLKO.1 2208 3UTR 100% 15.000 7.500 Y Rdh16 n/a
6 TRCN0000174061 CGCAGGAGAAACTTGTAAATA pLKO.1 2208 3UTR 100% 15.000 7.500 Y Rdh16 n/a
7 TRCN0000445030 GGGTGAAGGTGGCTATTATAG pLKO_005 673 CDS 100% 13.200 6.600 Y Rdh16 n/a
8 TRCN0000041456 GTGCCAGATTATGCTCAAATA pLKO.1 727 CDS 100% 13.200 6.600 Y Rdh16f2 n/a
9 TRCN0000041946 CAGCTCAGAAATCAGGGAGAT pLKO.1 770 CDS 100% 4.050 2.025 Y Rdh16 n/a
10 TRCN0000190157 GCTGAGGAACAAGACATCTGA pLKO.1 284 CDS 100% 3.000 1.500 Y Rdh18-ps n/a
11 TRCN0000041977 CGAATTGGACAAGAGGTGCAA pLKO.1 833 CDS 100% 2.640 1.320 Y Rdh9 n/a
12 TRCN0000202357 GAACAAGACATCTGACAGGCT pLKO.1 290 CDS 100% 0.660 0.330 Y Rdh18-ps n/a
13 TRCN0000041439 CCAAGACAAGTATGTCTTCAT pLKO.1 161 CDS 100% 0.495 0.248 Y Rdh19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153133.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.