Transcript: Human NM_153225.4

Homo sapiens somatomedin B and thrombospondin type 1 domain containing (SBSPON), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SBSPON (157869)
Length:
3698
CDS:
106..900

Additional Resources:

NCBI RefSeq record:
NM_153225.4
NBCI Gene record:
SBSPON (157869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153225.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428243 GTGACGGAAGTGTCATTTAAG pLKO_005 1235 3UTR 100% 13.200 18.480 N SBSPON n/a
2 TRCN0000113857 GCTGGATACTGTATGGAGTTT pLKO.1 601 CDS 100% 4.950 6.930 N SBSPON n/a
3 TRCN0000113856 CCACACTCTGAAGTAGAGAAA pLKO.1 1013 3UTR 100% 4.950 3.465 N SBSPON n/a
4 TRCN0000113858 CGGTGTCAAGGAACTTGGAAA pLKO.1 820 CDS 100% 4.950 3.465 N SBSPON n/a
5 TRCN0000437974 ACGGTGTGTGTGGATTGTCAG pLKO_005 703 CDS 100% 4.050 2.835 N SBSPON n/a
6 TRCN0000090897 TGCTGGATACTGTATGGAGTT pLKO.1 600 CDS 100% 4.050 2.835 N Sbspon n/a
7 TRCN0000113859 CCTTTATAACTACCTCTGCAT pLKO.1 521 CDS 100% 2.640 1.848 N SBSPON n/a
8 TRCN0000113860 GCTATGAACTCTGTGAGCCTT pLKO.1 730 CDS 100% 2.640 1.848 N SBSPON n/a
9 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2569 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153225.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13303 pDONR223 100% 98.1% 98.1% None 1_15del n/a
2 ccsbBroad304_13303 pLX_304 0% 98.1% 98.1% V5 1_15del n/a
3 TRCN0000476921 CTCTTCCACAATTAAGATATCTAA pLX_317 42.5% 98.1% 98.1% V5 1_15del n/a
Download CSV