Transcript: Human NM_153234.5

Homo sapiens limb and CNS expressed 1 (LIX1), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
LIX1 (167410)
Length:
3765
CDS:
36..884

Additional Resources:

NCBI RefSeq record:
NM_153234.5
NBCI Gene record:
LIX1 (167410)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153234.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191578 GTTGTGTCAATGTTACAGGAA pLKO.1 123 CDS 100% 2.640 3.696 N Lix1 n/a
2 TRCN0000412455 TTAGGTGAAGTAGCATGATAG pLKO_005 1261 3UTR 100% 10.800 8.640 N LIX1 n/a
3 TRCN0000424066 GTCTCTCAAGAGCTACGAATG pLKO_005 696 CDS 100% 6.000 4.800 N LIX1 n/a
4 TRCN0000129557 CGTGAAACAAAGTGTTCCCGA pLKO.1 573 CDS 100% 0.660 0.528 N LIX1 n/a
5 TRCN0000413436 GCAGAGGCCAGATTAACATTA pLKO_005 916 3UTR 100% 13.200 9.240 N LIX1 n/a
6 TRCN0000129257 CCTCAAACTGACACCATCTTA pLKO.1 2880 3UTR 100% 5.625 3.938 N LIX1 n/a
7 TRCN0000148070 GCACCCATTCTGTAAATTGAA pLKO.1 2970 3UTR 100% 5.625 3.938 N LIX1 n/a
8 TRCN0000147388 GCTCTGTTTGTTGTTCAAGAA pLKO.1 1822 3UTR 100% 4.950 3.465 N LIX1 n/a
9 TRCN0000131035 CTTTGTGAGTTACGTGACCCT pLKO.1 230 CDS 100% 0.660 0.462 N LIX1 n/a
10 TRCN0000129873 GTCTTCAAAGACTTGAACGTT pLKO.1 105 CDS 100% 0.300 0.210 N LIX1 n/a
11 TRCN0000147491 GCCCTTTGAGAATCTGATAAA pLKO.1 3345 3UTR 100% 13.200 7.920 N LIX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153234.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492018 CCTCCCCTTCTTATTATAAGGAAC pLX_317 39.6% 99.8% 99.6% V5 8G>T n/a
2 ccsbBroadEn_09767 pDONR223 100% 99.7% 99.2% None 8G>T;834G>N n/a
3 ccsbBroad304_09767 pLX_304 0% 99.7% 99.2% V5 8G>T;834G>N n/a
Download CSV