Transcript: Human NM_153237.2

Homo sapiens transmembrane protein 252 (TMEM252), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
TMEM252 (169693)
Length:
1261
CDS:
70..582

Additional Resources:

NCBI RefSeq record:
NM_153237.2
NBCI Gene record:
TMEM252 (169693)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153237.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424212 CTATCGCCAGGTGACTGAAAG pLKO_005 255 CDS 100% 10.800 15.120 N TMEM252 n/a
2 TRCN0000163647 GCATTCCTCCACCTCTATATA pLKO.1 428 CDS 100% 15.000 10.500 N TMEM252 n/a
3 TRCN0000166161 CAAAGGAGTGTTGAGGCACAT pLKO.1 276 CDS 100% 4.050 2.835 N TMEM252 n/a
4 TRCN0000164969 GATTGCGGCCTATTTGCTTCT pLKO.1 189 CDS 100% 4.050 2.835 N TMEM252 n/a
5 TRCN0000164945 GCTTATGAAGAGAGCCTTGAG pLKO.1 367 CDS 100% 4.050 2.835 N TMEM252 n/a
6 TRCN0000164695 CTGATTGCGGCCTATTTGCTT pLKO.1 187 CDS 100% 3.000 2.100 N TMEM252 n/a
7 TRCN0000166705 CCAGCTTATGAAGAGAGCCTT pLKO.1 364 CDS 100% 2.640 1.848 N TMEM252 n/a
8 TRCN0000125356 GTGATCCTTCTGAGTGGAATT pLKO.1 223 CDS 100% 0.000 0.000 N Tmem252 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153237.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05149 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05149 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466590 GCTGGACCTCCCTAGCACTTCTCG pLX_317 65.2% 100% 100% V5 n/a
Download CSV