Transcript: Human NM_153260.3

Homo sapiens leucine rich repeat containing 57 (LRRC57), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
LRRC57 (255252)
Length:
7097
CDS:
124..843

Additional Resources:

NCBI RefSeq record:
NM_153260.3
NBCI Gene record:
LRRC57 (255252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153260.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244806 ACCTCAACCAGAATCAGATAT pLKO_005 599 CDS 100% 13.200 9.240 N LRRC57 n/a
2 TRCN0000244807 TCTTGCTGTCCACGCCTTAAA pLKO_005 640 CDS 100% 13.200 9.240 N LRRC57 n/a
3 TRCN0000257095 AGAACCAGATTCGAAGTATAC pLKO_005 542 CDS 100% 10.800 7.560 N LRRC57 n/a
4 TRCN0000244805 CTAGAGACGCTAAGCCTAAAC pLKO_005 382 CDS 100% 10.800 7.560 N LRRC57 n/a
5 TRCN0000168127 GCCTTTGCTGATAGGAAAGTT pLKO.1 285 CDS 100% 5.625 3.938 N LRRC57 n/a
6 TRCN0000172794 GCTGCAAGTCATCGAACTCAA pLKO.1 579 CDS 100% 4.950 3.465 N LRRC57 n/a
7 TRCN0000172240 CTTCGAGAACTGGAAGGCTAT pLKO.1 775 CDS 100% 4.050 2.835 N LRRC57 n/a
8 TRCN0000244804 TGATACTTCAGGAGATTATAT pLKO_005 953 3UTR 100% 15.000 9.000 N LRRC57 n/a
9 TRCN0000139826 CCTCCTGAATAGCTGGGATTA pLKO.1 5550 3UTR 100% 10.800 5.400 Y SYNPO2 n/a
10 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1853 3UTR 100% 4.950 2.475 Y ORAI2 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2599 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2600 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1941 3UTR 100% 10.800 5.400 Y SMIM11A n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3662 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1850 3UTR 100% 4.950 2.475 Y LOC339059 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3662 3UTR 100% 5.625 2.813 Y EID2B n/a
17 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1613 3UTR 100% 4.950 2.475 Y DCAF11 n/a
18 TRCN0000168807 GCTGATCTCAAACTCCTGATA pLKO.1 4924 3UTR 100% 4.950 2.475 Y TMEM105 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153260.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05306 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05306 pLX_304 0% 100% 100% V5 n/a
Download CSV