Transcript: Human NM_153333.3

Homo sapiens transcription elongation factor A like 8 (TCEAL8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TCEAL8 (90843)
Length:
1174
CDS:
190..543

Additional Resources:

NCBI RefSeq record:
NM_153333.3
NBCI Gene record:
TCEAL8 (90843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153333.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440570 ATTCACGCAGCCGTCCTTATC pLKO_005 503 CDS 100% 10.800 15.120 N TCEAL8 n/a
2 TRCN0000428435 CAAACTTAACCAAGCTTATTT pLKO_005 897 3UTR 100% 15.000 12.000 N TCEAL8 n/a
3 TRCN0000435462 ACAAGTTTGTGATGATGCATT pLKO_005 470 CDS 100% 4.950 3.465 N TCEAL8 n/a
4 TRCN0000438533 GATCGCCCTTTGGAGGATGTA pLKO_005 250 CDS 100% 4.950 3.465 N TCEAL8 n/a
5 TRCN0000150881 GATGTATCTTTGACCTCCATT pLKO.1 602 3UTR 100% 4.950 3.465 N TCEAL8 n/a
6 TRCN0000150722 CCTGAAGAAATGATAAGAGGA pLKO.1 403 CDS 100% 2.640 1.848 N TCEAL8 n/a
7 TRCN0000155213 GAGCTTGAAAGGCTTAGGGAA pLKO.1 430 CDS 100% 2.640 1.848 N TCEAL8 n/a
8 TRCN0000154521 GAAATCCTCAACCTTCCGAAG pLKO.1 287 CDS 100% 2.250 1.575 N TCEAL8 n/a
9 TRCN0000434847 AGGGATTTAAAGAGGACACAC pLKO_005 365 CDS 100% 4.050 2.430 N TCEAL8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153333.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09306 pDONR223 100% 99.7% 99.1% None 340T>C n/a
2 ccsbBroad304_09306 pLX_304 0% 99.7% 99.1% V5 340T>C n/a
3 TRCN0000479060 ATCGTACTTTTTCCCCTATTTAAA pLX_317 100% 99.7% 99.1% V5 340T>C n/a
Download CSV