Transcript: Human NM_153376.3

Homo sapiens coiled-coil domain containing 96 (CCDC96), mRNA.

Source:
NCBI, updated 2019-05-17
Taxon:
Homo sapiens (human)
Gene:
CCDC96 (257236)
Length:
2153
CDS:
64..1731

Additional Resources:

NCBI RefSeq record:
NM_153376.3
NBCI Gene record:
CCDC96 (257236)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153376.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434248 ATTTGGGACGGGACTCTATTT pLKO_005 1826 3UTR 100% 13.200 18.480 N CCDC96 n/a
2 TRCN0000135004 CCAACAGTGTGCAAGTAATAA pLKO.1 1373 CDS 100% 15.000 10.500 N CCDC96 n/a
3 TRCN0000414105 GACGTGCTGTCCTGCTTTATT pLKO_005 1773 3UTR 100% 15.000 10.500 N CCDC96 n/a
4 TRCN0000134572 GAACCAAACCTTCAATGAGAA pLKO.1 1305 CDS 100% 4.950 3.465 N CCDC96 n/a
5 TRCN0000134745 GATTGAGAACCAAACCTTCAA pLKO.1 1299 CDS 100% 4.950 3.465 N CCDC96 n/a
6 TRCN0000135302 CAGCTGAAGATTGAGAACCAA pLKO.1 1291 CDS 100% 3.000 2.100 N CCDC96 n/a
7 TRCN0000134237 GAAGATTGAGAACCAAACCTT pLKO.1 1296 CDS 100% 3.000 2.100 N CCDC96 n/a
8 TRCN0000136032 GAGGAACGAAATGAGGAACTT pLKO.1 1330 CDS 100% 4.950 2.970 N CCDC96 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153376.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09922 pDONR223 100% 99.8% 99.8% None 286G>A;309T>C n/a
2 ccsbBroad304_09922 pLX_304 0% 99.8% 99.8% V5 286G>A;309T>C n/a
3 TRCN0000477626 TATAGGTTTAAAGACTAAGAGATG pLX_317 20.4% 99.8% 99.8% V5 286G>A;309T>C n/a
4 ccsbBroadEn_09921 pDONR223 100% 99.8% 99.8% None 66C>T;286G>A;309T>C n/a
5 ccsbBroad304_09921 pLX_304 0% 99.8% 99.8% V5 66C>T;286G>A;309T>C n/a
6 TRCN0000474484 CAAGATGCAGAGTCATAGACATTA pLX_317 10.3% 99.8% 99.8% V5 66C>T;286G>A;309T>C n/a
Download CSV