Transcript: Mouse NM_153457.7

Mus musculus reticulon 1 (Rtn1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Rtn1 (104001)
Length:
3632
CDS:
504..2846

Additional Resources:

NCBI RefSeq record:
NM_153457.7
NBCI Gene record:
Rtn1 (104001)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153457.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119371 GTGGCAAAGATCCAGGCTAAA pLKO.1 2796 CDS 100% 10.800 15.120 N Rtn1 n/a
2 TRCN0000119368 CGCATCTACAAGTCCGTTCTA pLKO.1 2430 CDS 100% 4.950 6.930 N Rtn1 n/a
3 TRCN0000119370 GATGAGTTGATTGCTGCCATT pLKO.1 1563 CDS 100% 4.050 2.835 N Rtn1 n/a
4 TRCN0000119367 GCAAATTGATTGTTTCCCTTT pLKO.1 2921 3UTR 100% 4.050 2.835 N Rtn1 n/a
5 TRCN0000119369 GCAGAAGCCTACAAATACATT pLKO.1 1074 CDS 100% 5.625 3.375 N Rtn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153457.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11112 pDONR223 100% 22.6% 23.9% None (many diffs) n/a
2 ccsbBroad304_11112 pLX_304 0% 22.6% 23.9% V5 (many diffs) n/a
3 TRCN0000470254 CCCCTCTTGGAGGTTCAATCCCAT pLX_317 57.8% 22.6% 23.9% V5 (many diffs) n/a
Download CSV