Transcript: Human NM_153464.3

Homo sapiens interleukin enhancer binding factor 3 (ILF3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
ILF3 (3609)
Length:
3198
CDS:
233..2305

Additional Resources:

NCBI RefSeq record:
NM_153464.3
NBCI Gene record:
ILF3 (3609)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153464.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014582 CCAGAGGACGACAGTAAAGAA pLKO.1 437 CDS 100% 5.625 3.938 N ILF3 n/a
2 TRCN0000329786 CCAGAGGACGACAGTAAAGAA pLKO_005 437 CDS 100% 5.625 3.938 N ILF3 n/a
3 TRCN0000014579 CCTTCCAAGATGCCCAAGAAA pLKO.1 1250 CDS 100% 5.625 3.938 N ILF3 n/a
4 TRCN0000329787 CCTTCCAAGATGCCCAAGAAA pLKO_005 1250 CDS 100% 5.625 3.938 N ILF3 n/a
5 TRCN0000014581 GCCATGTGATGGCAAAGCATT pLKO.1 267 CDS 100% 4.950 3.465 N ILF3 n/a
6 TRCN0000353628 GCCATGTGATGGCAAAGCATT pLKO_005 267 CDS 100% 4.950 3.465 N ILF3 n/a
7 TRCN0000014580 GCCAGATGGTTCTGGCATTTA pLKO.1 1087 CDS 100% 1.320 0.924 N ILF3 n/a
8 TRCN0000066793 CCCTGTTGTCAGAGAAGAAAT pLKO.1 751 CDS 100% 13.200 7.920 N Ilf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153464.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06449 pDONR223 100% 97.4% 97.3% None (many diffs) n/a
2 ccsbBroad304_06449 pLX_304 0% 97.4% 97.3% V5 (many diffs) n/a
3 TRCN0000467740 TATGAGTATTCTCCACCACAGTTG pLX_317 17.9% 97.4% 97.3% V5 (many diffs) n/a
Download CSV