Transcript: Mouse NM_153525.5

Mus musculus transmembrane protein 41B (Tmem41b), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tmem41b (233724)
Length:
3619
CDS:
149..1024

Additional Resources:

NCBI RefSeq record:
NM_153525.5
NBCI Gene record:
Tmem41b (233724)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153525.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200605 CGGTATTTATTCTGATGGTTT pLKO.1 942 CDS 100% 4.950 6.930 N Tmem41b n/a
2 TRCN0000293036 CGGTATTTATTCTGATGGTTT pLKO_005 942 CDS 100% 4.950 6.930 N Tmem41b n/a
3 TRCN0000200647 CGTTTCTTCCTAATTGGTTTA pLKO.1 771 CDS 100% 10.800 7.560 N Tmem41b n/a
4 TRCN0000293037 CGTTTCTTCCTAATTGGTTTA pLKO_005 771 CDS 100% 10.800 7.560 N Tmem41b n/a
5 TRCN0000200882 GTACAAGTATTGGTTGCTTAT pLKO.1 479 CDS 100% 10.800 7.560 N Tmem41b n/a
6 TRCN0000293038 GTACAAGTATTGGTTGCTTAT pLKO_005 479 CDS 100% 10.800 7.560 N Tmem41b n/a
7 TRCN0000190220 CTGCTACATGCTCTCCTACTT pLKO.1 634 CDS 100% 4.950 3.465 N Tmem41b n/a
8 TRCN0000310180 CTGCTACATGCTCTCCTACTT pLKO_005 634 CDS 100% 4.950 3.465 N Tmem41b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153525.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13686 pDONR223 100% 55.6% 36.7% None (many diffs) n/a
2 ccsbBroad304_13686 pLX_304 0% 55.6% 36.7% V5 (many diffs) n/a
3 TRCN0000476364 GATATCAAAAAACTAAAAACATCT pLX_317 60.1% 55.6% 36.7% V5 (many diffs) n/a
Download CSV