Transcript: Mouse NM_153542.1

Mus musculus leucine rich repeat containing 20 (Lrrc20), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Lrrc20 (216011)
Length:
2636
CDS:
123..677

Additional Resources:

NCBI RefSeq record:
NM_153542.1
NBCI Gene record:
Lrrc20 (216011)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153542.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248075 GAGACCACCTCCACCTATTTA pLKO_005 1127 3UTR 100% 15.000 10.500 N Lrrc20 n/a
2 TRCN0000248074 ACCGCTCATCAAGTTTGATAT pLKO_005 617 CDS 100% 13.200 9.240 N Lrrc20 n/a
3 TRCN0000248078 AGTTCATGACCACCTTCAATC pLKO_005 325 CDS 100% 10.800 7.560 N Lrrc20 n/a
4 TRCN0000248077 GAGTTGCGAGGAAGGTCAATG pLKO_005 154 CDS 100% 10.800 7.560 N Lrrc20 n/a
5 TRCN0000248076 TCATCACGCTGGCTAACAATG pLKO_005 283 CDS 100% 10.800 7.560 N Lrrc20 n/a
6 TRCN0000177862 CTCTGATCAGATCCATCTCAT pLKO.1 266 CDS 100% 4.950 3.465 N Lrrc20 n/a
7 TRCN0000178539 GAGGAGAATGAGATAGTGGAT pLKO.1 504 CDS 100% 2.640 1.848 N Lrrc20 n/a
8 TRCN0000198777 CCAGTTTCAAGACTTCCCAGA pLKO.1 443 CDS 100% 2.160 1.512 N Lrrc20 n/a
9 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 2504 3UTR 100% 2.640 1.320 Y Adsl n/a
10 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 2504 3UTR 100% 2.640 1.320 Y Adsl n/a
11 TRCN0000172428 CCAGCAAGTTCATGACCACAT pLKO.1 319 CDS 100% 4.050 2.835 N LRRC20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153542.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08493 pDONR223 100% 85% 89.6% None (many diffs) n/a
2 ccsbBroad304_08493 pLX_304 0% 85% 89.6% V5 (many diffs) n/a
3 TRCN0000474238 TCCAGCTGTTCCCGATGATCGTCT pLX_317 86.3% 85% 89.6% V5 (many diffs) n/a
Download CSV