Transcript: Mouse NM_153550.4

Mus musculus solute carrier family 49 member 4 (Slc49a4), mRNA.

Source:
NCBI, updated 2019-02-20
Taxon:
Mus musculus (mouse)
Gene:
Slc49a4 (224132)
Length:
5409
CDS:
130..1566

Additional Resources:

NCBI RefSeq record:
NM_153550.4
NBCI Gene record:
Slc49a4 (224132)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153550.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097663 CGAATCGAGACCGTGTTGTAT pLKO.1 808 CDS 100% 5.625 7.875 N Slc49a4 n/a
2 TRCN0000097660 GCCGCTAACTTCTGAAGACAT pLKO.1 1960 3UTR 100% 4.950 6.930 N Slc49a4 n/a
3 TRCN0000097661 CCTAAACAGCATCACCCACTT pLKO.1 1233 CDS 100% 4.050 5.670 N Slc49a4 n/a
4 TRCN0000097664 CAATCGCATCAATGCTGAGTT pLKO.1 680 CDS 100% 4.950 3.465 N Slc49a4 n/a
5 TRCN0000425411 GTGCTTCAGGGAATCCTATGA pLKO_005 1512 CDS 100% 4.950 3.465 N SLC49A4 n/a
6 TRCN0000097662 GACCGTGTTGTATGCAGAATT pLKO.1 816 CDS 100% 0.000 0.000 N Slc49a4 n/a
7 TRCN0000176490 CCTGGGTTCTATAAGAAAGTA pLKO.1 3710 3UTR 100% 5.625 2.813 Y Il1bos n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153550.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14321 pDONR223 100% 87.6% 93.9% None (many diffs) n/a
2 ccsbBroad304_14321 pLX_304 0% 87.6% 93.9% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000477346 CTCAAGGAAGTCTACGTTTCCCAG pLX_317 31% 87.6% 93.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV