Transcript: Mouse NM_153567.3

Mus musculus SLAIN motif family, member 2 (Slain2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Slain2 (75991)
Length:
4865
CDS:
264..2087

Additional Resources:

NCBI RefSeq record:
NM_153567.3
NBCI Gene record:
Slain2 (75991)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153567.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328811 CTAAGCAGTCGCCTCGAAATT pLKO_005 1327 CDS 100% 13.200 18.480 N Slain2 n/a
2 TRCN0000215434 GATCCAACTATAAGCTAAATG pLKO.1 1066 CDS 100% 13.200 18.480 N Slain2 n/a
3 TRCN0000216039 CAGTAGAAGTGACTCCAATTT pLKO.1 1556 CDS 100% 13.200 10.560 N Slain2 n/a
4 TRCN0000253837 TATCCACAAACTTGATCAAAC pLKO_005 773 CDS 100% 10.800 8.640 N SLAIN2 n/a
5 TRCN0000328755 TCAATTGGATCCAACTATAAG pLKO_005 1059 CDS 100% 13.200 9.240 N Slain2 n/a
6 TRCN0000215962 CAAATTCTTATAGTCCAAATG pLKO.1 853 CDS 100% 10.800 7.560 N Slain2 n/a
7 TRCN0000201163 GCTCTGGTTCATCTTGCAATT pLKO.1 1168 CDS 100% 10.800 7.560 N Slain2 n/a
8 TRCN0000328810 GGCAACCAGTGAAAGCGTTTA pLKO_005 1759 CDS 100% 10.800 7.560 N Slain2 n/a
9 TRCN0000191166 CCCAGGTTTCTATGATATGAT pLKO.1 2917 3UTR 100% 5.625 3.938 N Slain2 n/a
10 TRCN0000201370 GCCCAGAATTGTCACTTGTAT pLKO.1 4284 3UTR 100% 5.625 3.938 N Slain2 n/a
11 TRCN0000192834 GTTCTGGTAGCCAAGAAACTA pLKO.1 1795 CDS 100% 5.625 3.938 N Slain2 n/a
12 TRCN0000353432 GTTCTGGTAGCCAAGAAACTA pLKO_005 1795 CDS 100% 5.625 3.938 N Slain2 n/a
13 TRCN0000189728 GCAGAGAGAAAGGGAAGGAAA pLKO.1 3458 3UTR 100% 4.950 3.465 N Slain2 n/a
14 TRCN0000189729 GCCACTTCTCAAAGGCTGAAA pLKO.1 1623 CDS 100% 4.950 3.465 N Slain2 n/a
15 TRCN0000353433 CACTAGAAACACGGTTCATTT pLKO_005 2319 3UTR 100% 13.200 7.920 N Slain2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153567.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03835 pDONR223 100% 87% 89.8% None (many diffs) n/a
2 ccsbBroad304_03835 pLX_304 0% 87% 89.8% V5 (many diffs) n/a
3 TRCN0000477057 CTAGTAGACCTTGTTCCTCTTGGT pLX_317 20.8% 87% 89.8% V5 (many diffs) n/a
Download CSV