Transcript: Mouse NM_153582.5

Mus musculus CKLF-like MARVEL transmembrane domain containing 4 (Cmtm4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cmtm4 (97487)
Length:
7734
CDS:
172..798

Additional Resources:

NCBI RefSeq record:
NM_153582.5
NBCI Gene record:
Cmtm4 (97487)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153582.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126360 CGGAAATTGCTGCCGTGATAT pLKO.1 617 CDS 100% 13.200 18.480 N Cmtm4 n/a
2 TRCN0000126361 CCCAGATCAACTGGAATCTAA pLKO.1 512 CDS 100% 5.625 4.500 N Cmtm4 n/a
3 TRCN0000126362 CCAAGTGATTCTGGCCTTGAT pLKO.1 351 CDS 100% 4.950 3.465 N Cmtm4 n/a
4 TRCN0000126359 CCGACTTTAATGACTGCTCTA pLKO.1 1022 3UTR 100% 4.050 2.835 N Cmtm4 n/a
5 TRCN0000126363 CTCTACTTCTTTGAGTTCGTA pLKO.1 421 CDS 100% 3.000 2.100 N Cmtm4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153582.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04983 pDONR223 100% 92.3% 95.6% None (many diffs) n/a
2 ccsbBroad304_04983 pLX_304 0% 92.3% 95.6% V5 (many diffs) n/a
3 TRCN0000477858 GTCCAGCACCTCTTCTTATCTTAT pLX_317 71.8% 92.3% 95.6% V5 (many diffs) n/a
Download CSV