Transcript: Human NM_153604.3

Homo sapiens myocardin (MYOCD), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
MYOCD (93649)
Length:
8436
CDS:
300..3116

Additional Resources:

NCBI RefSeq record:
NM_153604.3
NBCI Gene record:
MYOCD (93649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150966 GCTTATTGAAAGCGGAGAAAT pLKO.1 2528 CDS 100% 13.200 18.480 N MYOCD n/a
2 TRCN0000151657 CGACTTGGTTAATATGCACAT pLKO.1 524 CDS 100% 4.050 5.670 N MYOCD n/a
3 TRCN0000427261 TGGATGTCACTGATCTCAATT pLKO_005 3058 CDS 100% 13.200 9.240 N MYOCD n/a
4 TRCN0000434602 AGCATCTTCAACATCGATTTC pLKO_005 3036 CDS 100% 10.800 7.560 N MYOCD n/a
5 TRCN0000151465 CAGCTTAAGGAACCAAATGAA pLKO.1 1263 CDS 100% 5.625 3.938 N MYOCD n/a
6 TRCN0000150565 GATGAGCATCTTGAAGTCTTA pLKO.1 2709 CDS 100% 4.950 3.465 N MYOCD n/a
7 TRCN0000155961 CAACTGGCTAACCAAGGCATA pLKO.1 393 CDS 100% 4.050 2.835 N MYOCD n/a
8 TRCN0000155795 CCATCCTATGAAGATGCCGTA pLKO.1 2460 CDS 100% 2.160 1.512 N MYOCD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153604.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09360 pDONR223 99.7% 95% 95.1% None 936A>G;2056_2057ins144 n/a
2 TRCN0000492187 TCGTGGGCATTCTTTATCGAAATA pLX_317 14.9% 95% 95.1% V5 936A>G;2056_2057ins144 n/a
Download CSV