Transcript: Human NM_153607.3

Homo sapiens CREB3 regulatory factor (CREBRF), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CREBRF (153222)
Length:
7778
CDS:
320..2239

Additional Resources:

NCBI RefSeq record:
NM_153607.3
NBCI Gene record:
CREBRF (153222)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153607.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415329 AGAGCATAAACCATGATTAAA pLKO_005 2421 3UTR 100% 15.000 10.500 N CREBRF n/a
2 TRCN0000435561 ACCCACTTCAAGCACACAAAT pLKO_005 937 CDS 100% 13.200 9.240 N CREBRF n/a
3 TRCN0000435351 AGAAGCTTGAAATCCTCATTA pLKO_005 2091 CDS 100% 13.200 9.240 N CREBRF n/a
4 TRCN0000431955 AGACCAACATGTATCATAATG pLKO_005 966 CDS 100% 13.200 9.240 N CREBRF n/a
5 TRCN0000167429 GCAGCGATACTTGATCTATAT pLKO.1 4964 3UTR 100% 13.200 9.240 N CREBRF n/a
6 TRCN0000168691 GCCAAGTATTGTGGCAGATTT pLKO.1 2549 3UTR 100% 13.200 9.240 N CREBRF n/a
7 TRCN0000172560 GCTGGGCAAACCTCAGAATTT pLKO.1 2135 CDS 100% 13.200 9.240 N CREBRF n/a
8 TRCN0000434868 TCCAACTTTAGCTCAACTTAA pLKO_005 727 CDS 100% 13.200 9.240 N CREBRF n/a
9 TRCN0000423530 GTAGAAGACCTGACTCCAAAT pLKO_005 1772 CDS 100% 10.800 7.560 N CREBRF n/a
10 TRCN0000191827 GCTTACATGATACTGTATGAA pLKO.1 3206 3UTR 100% 5.625 3.938 N Crebrf n/a
11 TRCN0000168109 CCAGTACATCAGTCTCAGATT pLKO.1 1281 CDS 100% 4.950 3.465 N CREBRF n/a
12 TRCN0000168242 CCGAGATACTTTGCCAAGTAA pLKO.1 1687 CDS 100% 0.563 0.394 N CREBRF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153607.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09694 pDONR223 100% 99.9% 99.8% None 1447A>G n/a
2 ccsbBroad304_09694 pLX_304 0% 99.9% 99.8% V5 1447A>G n/a
3 TRCN0000479310 TAACTTGGCACGGGCCATGCGCCC pLX_317 23.5% 99.9% 99.8% V5 1447A>G n/a
Download CSV