Transcript: Human NM_153699.1

Homo sapiens glutathione S-transferase alpha 5 (GSTA5), mRNA.

Source:
NCBI, updated 2019-06-07
Taxon:
Homo sapiens (human)
Gene:
GSTA5 (221357)
Length:
845
CDS:
71..739

Additional Resources:

NCBI RefSeq record:
NM_153699.1
NBCI Gene record:
GSTA5 (221357)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159983 CTGATTGATATGTACACAGAA pLKO.1 341 CDS 100% 4.950 3.465 N GSTA5 n/a
2 TRCN0000413325 GTACACAGAAGGTATAGTAGA pLKO_005 352 CDS 100% 4.950 3.465 N GSTA5 n/a
3 TRCN0000427456 AGAGAAAGCCTCCCATGGATG pLKO_005 678 CDS 100% 4.050 2.835 N GSTA5 n/a
4 TRCN0000416521 CAGTATGGAGTCCATTCGGTG pLKO_005 112 CDS 100% 2.160 1.512 N GSTA5 n/a
5 TRCN0000162050 CTCATATGTCAACCAGAGGAA pLKO.1 398 CDS 100% 0.000 0.000 N GSTA5 n/a
6 TRCN0000159927 CAGAGCCATTCTTAACTACAT pLKO.1 274 CDS 100% 4.950 2.970 N GSTA5 n/a
7 TRCN0000160220 CTTAACTACATTGCCAGCAAA pLKO.1 284 CDS 100% 4.950 2.970 N GSTA5 n/a
8 TRCN0000161825 CACAGACAAGACTACCTTGTT pLKO.1 497 CDS 100% 0.495 0.297 N GSTA5 n/a
9 TRCN0000152045 CCCATGGATGAGAAATCTTTA pLKO.1 689 CDS 100% 13.200 6.600 Y GSTA2 n/a
10 TRCN0000160006 CCCATGGATGAGAAATCTTTA pLKO.1 689 CDS 100% 13.200 6.600 Y GSTA5 n/a
11 TRCN0000159827 GCCAGCAAATACAACCTTTAT pLKO.1 296 CDS 100% 13.200 6.600 Y GSTA5 n/a
12 TRCN0000162921 GCTACTTCCCTGCCTTTGAAA pLKO.1 462 CDS 100% 5.625 2.813 Y GSTA1 n/a
13 TRCN0000156888 GACATTCACCTGGTGGAACTT pLKO.1 539 CDS 100% 4.950 2.475 Y GSTA2 n/a
14 TRCN0000161712 GCAAGTACCAATGGTTGAGAT pLKO.1 229 CDS 100% 4.950 2.475 Y GSTA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00701 pDONR223 100% 93.5% 90% None (many diffs) n/a
2 ccsbBroad304_00701 pLX_304 0% 93.5% 90% V5 (many diffs) n/a
3 TRCN0000469010 TTTTTAGACCATACGTGGGATTTT pLX_317 51.7% 93.5% 90% V5 (many diffs) n/a
4 ccsbBroadEn_06330 pDONR223 100% 92.7% 88.7% None (many diffs) n/a
5 ccsbBroad304_06330 pLX_304 0% 92.7% 88.7% V5 (many diffs) n/a
6 TRCN0000467221 TTACCGAGATCTCTTTTCATATCT pLX_317 52.1% 92.7% 88.7% V5 (many diffs) n/a
Download CSV