Transcript: Human NM_153770.3

Homo sapiens calcium binding tyrosine phosphorylation regulated (CABYR), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CABYR (26256)
Length:
831
CDS:
82..747

Additional Resources:

NCBI RefSeq record:
NM_153770.3
NBCI Gene record:
CABYR (26256)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054203 CCACCCAGTTTCCATCAGTTT pLKO.1 437 CDS 100% 4.950 3.960 N CABYR n/a
2 TRCN0000365434 GGAATACTACTATGGATATAA pLKO_005 227 CDS 100% 15.000 10.500 N CABYR n/a
3 TRCN0000054205 CCATCAAACATCAACCAGTTT pLKO.1 169 CDS 100% 4.950 3.465 N CABYR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08007 pDONR223 100% 58.3% 58.3% None 538_539ins474 n/a
2 ccsbBroad304_08007 pLX_304 0% 58.3% 58.3% V5 538_539ins474 n/a
3 TRCN0000468753 TCCGTATTGGTCCCTTTAACAATA pLX_317 42.6% 58.3% 58.3% V5 538_539ins474 n/a
Download CSV