Transcript: Mouse NM_153781.1

Mus musculus brain glycogen phosphorylase (Pygb), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Pygb (110078)
Length:
3860
CDS:
73..2604

Additional Resources:

NCBI RefSeq record:
NM_153781.1
NBCI Gene record:
Pygb (110078)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246771 TACGGCTATGGAATCCGATAT pLKO_005 538 CDS 100% 10.800 15.120 N Pygb n/a
2 TRCN0000246768 TCTGCTAGGCTGACGACTAAG pLKO_005 3385 3UTR 100% 10.800 15.120 N Pygb n/a
3 TRCN0000246767 CACGACAGATTCAAGGTATTT pLKO_005 2377 CDS 100% 13.200 9.240 N Pygb n/a
4 TRCN0000246769 TCACCCTGTACAACCGAATAA pLKO_005 1826 CDS 100% 13.200 9.240 N Pygb n/a
5 TRCN0000190221 CCGTGTGTCTTTAGCTGAGAA pLKO.1 2019 CDS 100% 4.950 3.465 N Pygb n/a
6 TRCN0000202491 GCTTCAACAGACACCTGCATT pLKO.1 164 CDS 100% 4.950 3.465 N Pygb n/a
7 TRCN0000246770 GCACGCAGCAGCATTACTATG pLKO_005 281 CDS 100% 10.800 6.480 N Pygb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488953 AACGGCTTCCAACTAGCTATTCCA pLX_317 14.6% 88.6% 95.4% V5 (many diffs) n/a
2 ccsbBroadEn_01354 pDONR223 100% 88.6% 95.6% None (many diffs) n/a
3 ccsbBroad304_01354 pLX_304 0% 88.6% 95.6% V5 (many diffs) n/a
4 TRCN0000480378 CGCTCAATGTCCTCACGCTCAAGT pLX_317 15.6% 88.6% 95.6% V5 (many diffs) n/a
5 TRCN0000489102 TAACCAATGCGCTCTTCTCTCACT pLX_317 4.1% 88.3% 95.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV