Transcript: Human NM_153824.3

Homo sapiens pyrroline-5-carboxylate reductase 1 (PYCR1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PYCR1 (5831)
Length:
1926
CDS:
487..1437

Additional Resources:

NCBI RefSeq record:
NM_153824.3
NBCI Gene record:
PYCR1 (5831)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038979 CACAGTTTCTGCTCTCAGGAA pLKO.1 606 CDS 100% 2.640 1.848 N PYCR1 n/a
2 TRCN0000038983 TGAGAAGAAGCTGTCAGCGTT pLKO.1 798 CDS 100% 2.640 1.848 N PYCR1 n/a
3 TRCN0000038982 CCTGCTCATCAACGCTGTGGA pLKO.1 1242 CDS 100% 0.880 0.616 N PYCR1 n/a
4 TRCN0000038981 GAGGGTCTTCACCCACTCCTA pLKO.1 1384 CDS 100% 0.880 0.616 N PYCR1 n/a
5 TRCN0000038980 CCCTTCATCCTGGATGAAATA pLKO.1 712 CDS 100% 1.320 0.792 N PYCR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153824.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06828 pDONR223 100% 93.2% 93.7% None (many diffs) n/a
2 ccsbBroad304_06828 pLX_304 0% 93.2% 93.7% V5 (many diffs) n/a
3 TRCN0000469386 GACCCGACGTAATGTCCATTCTTG pLX_317 34.8% 93.2% 93.7% V5 (many diffs) n/a
4 ccsbBroadEn_15557 pDONR223 0% 47.9% 47.5% None (many diffs) n/a
5 ccsbBroad304_15557 pLX_304 0% 47.9% 47.5% V5 (many diffs) n/a
6 TRCN0000469155 AATCCCCCGACCGCGGCCGTCCAG pLX_317 63.7% 47.9% 47.5% V5 (many diffs) n/a
Download CSV