Transcript: Mouse NM_170778.2

Mus musculus dihydropyrimidine dehydrogenase (Dpyd), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Dpyd (99586)
Length:
4437
CDS:
99..3176

Additional Resources:

NCBI RefSeq record:
NM_170778.2
NBCI Gene record:
Dpyd (99586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_170778.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041961 CCACGGAAGGTTATAGTCAAA pLKO.1 1275 CDS 100% 4.950 6.930 N Dpyd n/a
2 TRCN0000041959 CCACATCTCTTGACATTAAAT pLKO.1 373 CDS 100% 15.000 12.000 N Dpyd n/a
3 TRCN0000041962 CGCTATTCAGAATCAGGACTT pLKO.1 2549 CDS 100% 4.050 3.240 N Dpyd n/a
4 TRCN0000041958 CCTGCCATCAAGGATGTAATT pLKO.1 2853 CDS 100% 13.200 9.240 N Dpyd n/a
5 TRCN0000041960 CGCAGCCAAGAAACTAGACAA pLKO.1 191 CDS 100% 4.950 3.465 N Dpyd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_170778.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00459 pDONR223 100% 14.3% 14.3% None (many diffs) n/a
2 ccsbBroad304_00459 pLX_304 0% 14.3% 14.3% V5 (many diffs) n/a
3 TRCN0000475366 GACCTTCGACGGTTGATCCGTAAA pLX_317 19.8% 14.3% 14.3% V5 (many diffs) n/a
Download CSV