Transcript: Human NM_170780.3

Homo sapiens CD200 receptor 1 (CD200R1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CD200R1 (131450)
Length:
3696
CDS:
247..1224

Additional Resources:

NCBI RefSeq record:
NM_170780.3
NBCI Gene record:
CD200R1 (131450)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_170780.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422512 GTGTATCCTTTCAGAATATTT pLKO_005 1555 3UTR 100% 15.000 10.500 N CD200R1 n/a
2 TRCN0000417197 CCATCACTCATGACGGGTATT pLKO_005 614 CDS 100% 10.800 7.560 N CD200R1 n/a
3 TRCN0000061145 GCAGTTTATGTATGGATGAAA pLKO.1 320 CDS 100% 5.625 3.938 N CD200R1 n/a
4 TRCN0000061143 CCTTACATATACATGCACATA pLKO.1 1632 3UTR 100% 4.950 3.465 N CD200R1 n/a
5 TRCN0000061147 GAGAAGAACAATCCTCTCTAT pLKO.1 1132 CDS 100% 4.950 2.970 N CD200R1 n/a
6 TRCN0000061144 GCCTACAAGAAAGAAACAAAT pLKO.1 505 CDS 100% 13.200 6.600 Y CD200R1 n/a
7 TRCN0000159609 GCCTACAAGAAAGAAACAAAT pLKO.1 505 CDS 100% 13.200 6.600 Y CD200R1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_170780.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04873 pDONR223 100% 93.3% 93.3% None 66_67ins69 n/a
2 ccsbBroad304_04873 pLX_304 0% 93.3% 93.3% V5 66_67ins69 n/a
3 TRCN0000477514 CGACCTGAAACTGACTGTGTTTGC pLX_317 42.6% 93.3% 93.3% V5 66_67ins69 n/a
Download CSV