Transcript: Human NM_172020.4

Homo sapiens POM121 transmembrane nucleoporin (POM121), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
POM121 (9883)
Length:
5498
CDS:
457..3411

Additional Resources:

NCBI RefSeq record:
NM_172020.4
NBCI Gene record:
POM121 (9883)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172020.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416775 GGGCTATCCGTAAAGCTTTAT pLKO_005 3831 3UTR 100% 13.200 9.240 N POM121 n/a
2 TRCN0000444257 ACTCGGCGTTTGGGTTGAAAG pLKO_005 2765 CDS 100% 10.800 6.480 N POM121 n/a
3 TRCN0000060071 CCATGTGCAAAGGAGACAGTA pLKO.1 577 CDS 100% 4.950 2.970 N POM121 n/a
4 TRCN0000156699 CTGCGATACCAGAGCAGATAA pLKO.1 515 CDS 100% 13.200 6.600 Y POMZP3 n/a
5 TRCN0000255860 GCGATACCAGAGCAGATAATC pLKO_005 517 CDS 100% 13.200 6.600 Y POM121C n/a
6 TRCN0000255858 GCGTTTGGCTTTGGCATAAAC pLKO_005 2164 CDS 100% 13.200 6.600 Y POM121C n/a
7 TRCN0000438142 GGTGTGCACCTGATGGGATTT pLKO_005 3803 3UTR 100% 10.800 5.400 Y POM121 n/a
8 TRCN0000060069 CCAGTTCATCACCCTTCTCTA pLKO.1 956 CDS 100% 4.950 2.475 Y POM121 n/a
9 TRCN0000060070 CCCACTGTTAGAGAGCTTGAA pLKO.1 1446 CDS 100% 4.950 2.475 Y POM121 n/a
10 TRCN0000154080 CAGAGCAGATAATCAGCTCAA pLKO.1 524 CDS 100% 4.050 2.025 Y POMZP3 n/a
11 TRCN0000060068 CCCACGTTCAACATTCCCTTT pLKO.1 2497 CDS 100% 4.050 2.025 Y POM121 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172020.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07502 pDONR223 100% 99.9% 100% None 321G>C n/a
2 ccsbBroad304_07502 pLX_304 0% 99.9% 100% V5 321G>C n/a
3 TRCN0000479174 AGTTAAGCCATTGAGTCCCAAACC pLX_317 11.1% 99.9% 100% V5 321G>C n/a
Download CSV