Transcript: Human NM_172057.2

Homo sapiens potassium voltage-gated channel subfamily H member 2 (KCNH2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
KCNH2 (3757)
Length:
3212
CDS:
327..2786

Additional Resources:

NCBI RefSeq record:
NM_172057.2
NBCI Gene record:
KCNH2 (3757)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172057.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021714 CCTGCGAGATACCAACATGAT pLKO.1 1889 CDS 100% 4.950 6.930 N KCNH2 n/a
2 TRCN0000422341 GAGGGCATTAGCTGGTCTAAC pLKO_005 3019 3UTR 100% 10.800 7.560 N KCNH2 n/a
3 TRCN0000068385 CCCTCCATCAAGGACAAGTAT pLKO.1 1119 CDS 100% 5.625 3.938 N Kcnh2 n/a
4 TRCN0000429152 CAGATAGGCAAACCCTACAAC pLKO_005 1080 CDS 100% 4.950 3.465 N KCNH2 n/a
5 TRCN0000021717 CCTCATGTATGCTAGCATCTT pLKO.1 1253 CDS 100% 4.950 3.465 N KCNH2 n/a
6 TRCN0000436356 CTCACCTTGGACTCGCTTTCT pLKO_005 2613 CDS 100% 4.950 3.465 N KCNH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172057.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14289 pDONR223 100% 26% 23.3% None (many diffs) n/a
2 ccsbBroad304_14289 pLX_304 0% 26% 23.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000468367 GATACGGCATTCACCCGCCGGGGG pLX_317 29% 26% 23.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV