Transcript: Mouse NM_172148.1

Mus musculus B9 protein domain 2 (B9d2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
B9d2 (232987)
Length:
1058
CDS:
230..757

Additional Resources:

NCBI RefSeq record:
NM_172148.1
NBCI Gene record:
B9d2 (232987)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184487 GACCTGCACTTCGCTACTAAA pLKO.1 413 CDS 100% 13.200 18.480 N B9d2 n/a
2 TRCN0000247521 GACCTGCACTTCGCTACTAAA pLKO_005 413 CDS 100% 13.200 18.480 N B9d2 n/a
3 TRCN0000247525 ATCGCTATGGAGTGGAGTGTT pLKO_005 735 CDS 100% 4.950 6.930 N B9d2 n/a
4 TRCN0000247524 TGCACGCAGATACCATCTACA pLKO_005 633 CDS 100% 4.950 6.930 N B9d2 n/a
5 TRCN0000196139 GCACTTCGCTACTAAAGGTCT pLKO.1 418 CDS 100% 2.640 2.112 N B9d2 n/a
6 TRCN0000247523 GGGACTTCATTGCTACTAATC pLKO_005 758 CDS 100% 10.800 7.560 N B9d2 n/a
7 TRCN0000195896 CCATCATCCACTGAGCACATA pLKO.1 780 3UTR 100% 4.950 3.465 N B9d2 n/a
8 TRCN0000247522 CAGCTTGCTGGCTATGGCTTT pLKO_005 497 CDS 100% 4.050 2.430 N B9d2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172148.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09049 pDONR223 100% 88% 96% None (many diffs) n/a
2 ccsbBroad304_09049 pLX_304 0% 88% 96% V5 (many diffs) n/a
3 TRCN0000472977 GAGCAGCCAAATAGGCTGCGAAAT pLX_317 67.1% 88% 96% V5 (many diffs) n/a
Download CSV