Transcript: Human NM_172244.3

Homo sapiens sarcoglycan delta (SGCD), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SGCD (6444)
Length:
1166
CDS:
113..883

Additional Resources:

NCBI RefSeq record:
NM_172244.3
NBCI Gene record:
SGCD (6444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118873 GCGGAAACGATGCCTGTATTT pLKO.1 202 CDS 100% 13.200 18.480 N SGCD n/a
2 TRCN0000296170 GCCGTAGAAGCTTATGGTAAA pLKO_005 503 CDS 100% 10.800 15.120 N SGCD n/a
3 TRCN0000098389 GAACTTCACAATTGATGGAAT pLKO.1 292 CDS 100% 4.950 6.930 N Sgcd n/a
4 TRCN0000308090 AGTGCTAACTCAGCTTATAAC pLKO_005 472 CDS 100% 13.200 10.560 N SGCD n/a
5 TRCN0000118874 GCACAGTGTTCCCTAAATCTA pLKO.1 624 CDS 100% 5.625 4.500 N SGCD n/a
6 TRCN0000118876 CATCTGGATTCTCAAAGTCAT pLKO.1 271 CDS 100% 4.950 3.465 N SGCD n/a
7 TRCN0000118875 GAGCTGAAAGATTACGAGTTT pLKO.1 591 CDS 100% 4.950 3.465 N SGCD n/a
8 TRCN0000289129 GAGCTGAAAGATTACGAGTTT pLKO_005 591 CDS 100% 4.950 3.465 N SGCD n/a
9 TRCN0000098388 CCCGACCAGGTAATGCCCTAT pLKO.1 399 CDS 100% 1.350 1.890 N Sgcd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06941 pDONR223 100% 85.4% 80.4% None (many diffs) n/a
2 ccsbBroad304_06941 pLX_304 0% 85.4% 80.4% V5 (many diffs) n/a
3 TRCN0000474344 CATTGCGAATTACTTGTACTAGAC pLX_317 54.8% 85.4% 80.4% V5 (many diffs) n/a
Download CSV