Transcript: Mouse NM_172287.2

Mus musculus spire homolog 2 (Drosophila) (Spire2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Spire2 (234857)
Length:
2399
CDS:
53..2209

Additional Resources:

NCBI RefSeq record:
NM_172287.2
NBCI Gene record:
Spire2 (234857)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257899 GTGCACTTCCTGTAGCGTAAA pLKO_005 1849 CDS 100% 10.800 8.640 N Spire2 n/a
2 TRCN0000249496 CAGACCCAGTCCCTCTATATC pLKO_005 2159 CDS 100% 13.200 9.240 N Spire2 n/a
3 TRCN0000249498 GAAGGACGCACATGAACTTAT pLKO_005 982 CDS 100% 13.200 9.240 N Spire2 n/a
4 TRCN0000249497 TCACTGGGCTTTGCCATTTAC pLKO_005 362 CDS 100% 13.200 9.240 N Spire2 n/a
5 TRCN0000257902 TATCCGTGCCAGGAACTATAA pLKO_005 916 CDS 100% 13.200 7.920 N Spire2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12824 pDONR223 100% 67.2% 68.6% None (many diffs) n/a
2 ccsbBroad304_12824 pLX_304 0% 67.2% 68.6% V5 (many diffs) n/a
3 TRCN0000480204 CCATATTCCCACACGGTTTCGACG pLX_317 25.3% 67.2% 68.6% V5 (many diffs) n/a
Download CSV