Transcript: Human NM_172347.2

Homo sapiens potassium voltage-gated channel modifier subfamily G member 4 (KCNG4), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
KCNG4 (93107)
Length:
2779
CDS:
122..1681

Additional Resources:

NCBI RefSeq record:
NM_172347.2
NBCI Gene record:
KCNG4 (93107)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_172347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043879 CGTGCAGCTCTGCGATGATTA pLKO.1 412 CDS 100% 13.200 9.240 N KCNG4 n/a
2 TRCN0000043878 GCCGTCCATCAAGGGCCTTTA pLKO.1 220 CDS 100% 3.600 2.520 N KCNG4 n/a
3 TRCN0000043881 CGGGAAGGTCTTCGCTTGCCT pLKO.1 778 CDS 100% 0.000 0.000 N KCNG4 n/a
4 TRCN0000043880 AGTGGACCTGAAGAAGGAGAT pLKO.1 283 CDS 100% 4.050 2.430 N KCNG4 n/a
5 TRCN0000043882 CTGTCGGAGCTACGAGGAGAT pLKO.1 391 CDS 100% 1.350 0.810 N KCNG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172347.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09353 pDONR223 100% 99.8% 99.6% None 961G>A;1280G>A n/a
2 ccsbBroad304_09353 pLX_304 0% 99.8% 99.6% V5 961G>A;1280G>A n/a
3 TRCN0000470298 AAATGAAGATTTCGAAACTTTGAA pLX_317 28.5% 99.8% 99.6% V5 961G>A;1280G>A n/a
4 ccsbBroadEn_12990 pDONR223 100% 49% 48.5% None (many diffs) n/a
5 ccsbBroad304_12990 pLX_304 0% 49% 48.5% V5 (many diffs) n/a
6 TRCN0000470250 ACAAGGCCCCGGGGTCAATTCAAA pLX_317 59% 49% 48.5% V5 (many diffs) n/a
Download CSV