Transcript: Mouse NM_172399.3

Mus musculus neuron-derived neurotrophic factor (Ndnf), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ndnf (68169)
Length:
4684
CDS:
493..2199

Additional Resources:

NCBI RefSeq record:
NM_172399.3
NBCI Gene record:
Ndnf (68169)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172399.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217892 GATACACCTAGAAGGTATTTC pLKO.1 667 CDS 100% 13.200 18.480 N Ndnf n/a
2 TRCN0000430947 CCATACCCTGAATTACCATAT pLKO_005 1006 CDS 100% 10.800 15.120 N Ndnf n/a
3 TRCN0000193603 GCTTTATTTAAGCAGCTTCAA pLKO.1 3879 3UTR 100% 4.950 6.930 N Ndnf n/a
4 TRCN0000173539 GATGTTTACGTCGTAGGACAT pLKO.1 2122 CDS 100% 4.050 5.670 N Ndnf n/a
5 TRCN0000426650 AGATACACCTAGAAGGTATTT pLKO_005 666 CDS 100% 13.200 10.560 N Ndnf n/a
6 TRCN0000174542 CCAATACTACTTTGATGTCTT pLKO.1 1416 CDS 100% 4.950 3.960 N Ndnf n/a
7 TRCN0000216068 CATCAACAAGGAGCACAATTT pLKO.1 1134 CDS 100% 13.200 9.240 N Ndnf n/a
8 TRCN0000426065 ACACTCTGTGAAGTATCAAAG pLKO_005 2148 CDS 100% 10.800 7.560 N Ndnf n/a
9 TRCN0000173650 CCCGAAGACACAAGAATCAAA pLKO.1 1834 CDS 100% 5.625 3.938 N Ndnf n/a
10 TRCN0000174766 GCACACATTCACAAATGCAAA pLKO.1 2511 3UTR 100% 4.950 3.465 N Ndnf n/a
11 TRCN0000173302 GCACAGAACTATTCTCCTACA pLKO.1 857 CDS 100% 4.050 2.835 N Ndnf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172399.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12576 pDONR223 100% 49.8% 51.2% None (many diffs) n/a
2 ccsbBroad304_12576 pLX_304 0% 49.8% 51.2% V5 (many diffs) n/a
3 TRCN0000469126 AAAAAACACTCAGTGTGAAACCGC pLX_317 41.2% 49.8% 51.2% V5 (many diffs) n/a
Download CSV