Transcript: Mouse NM_172406.3

Mus musculus trafficking protein, kinesin binding 2 (Trak2), mRNA.

Source:
NCBI, updated 2017-05-07
Taxon:
Mus musculus (mouse)
Gene:
Trak2 (70827)
Length:
6286
CDS:
445..3186

Additional Resources:

NCBI RefSeq record:
NM_172406.3
NBCI Gene record:
Trak2 (70827)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119393 CCACAGTATAAGCTAAGAGTA pLKO.1 598 CDS 100% 4.950 6.930 N Trak2 n/a
2 TRCN0000119396 GCTTGTCATATCAAGACAGAA pLKO.1 1135 CDS 100% 4.950 3.960 N Trak2 n/a
3 TRCN0000119392 CCCAGATAGATTCCTTGGTAT pLKO.1 3782 3UTR 100% 4.950 3.465 N Trak2 n/a
4 TRCN0000119394 CCTCTTCAACTGGAGCAGAAA pLKO.1 2311 CDS 100% 4.950 3.465 N Trak2 n/a
5 TRCN0000119395 CCTGCAAGAAATGTATGGCTT pLKO.1 2874 CDS 100% 2.640 1.848 N Trak2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08898 pDONR223 100% 84.9% 86.9% None (many diffs) n/a
2 ccsbBroad304_08898 pLX_304 0% 84.9% 86.9% V5 (many diffs) n/a
3 TRCN0000474204 ACGGCAACGGTGATGGCTCCCGGC pLX_317 10.1% 84.9% 86.9% V5 (many diffs) n/a
Download CSV