Transcript: Mouse NM_172479.3

Mus musculus solute carrier family 38, member 5 (Slc38a5), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Slc38a5 (209837)
Length:
1878
CDS:
103..1542

Additional Resources:

NCBI RefSeq record:
NM_172479.3
NBCI Gene record:
Slc38a5 (209837)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172479.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069389 CCGCGATATCTTTGGGTTTAT pLKO.1 1314 CDS 100% 13.200 18.480 N Slc38a5 n/a
2 TRCN0000069388 CGGAGCTATGTTCATCATGTA pLKO.1 1017 CDS 100% 4.950 6.930 N Slc38a5 n/a
3 TRCN0000069391 CAGTGTCTTCTACCTCCGTAT pLKO.1 1374 CDS 100% 4.050 5.670 N Slc38a5 n/a
4 TRCN0000069392 CTGCCCATCTACACAGAACTT pLKO.1 949 CDS 100% 4.950 3.465 N Slc38a5 n/a
5 TRCN0000069390 CTGTTCATCATCAAATCTGAA pLKO.1 559 CDS 100% 4.950 3.465 N Slc38a5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172479.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04590 pDONR223 100% 84.6% 85.6% None (many diffs) n/a
2 ccsbBroad304_04590 pLX_304 0% 84.6% 85.6% V5 (many diffs) n/a
3 TRCN0000474184 CTGGACCATGTTACGACTAACTTT pLX_317 40.1% 84.6% 85.6% V5 (many diffs) n/a
Download CSV