Transcript: Mouse NM_172527.2

Mus musculus nudix (nucleoside diphosphate linked moiety X)-type motif 15 (Nudt15), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Nudt15 (214254)
Length:
2592
CDS:
430..942

Additional Resources:

NCBI RefSeq record:
NM_172527.2
NBCI Gene record:
Nudt15 (214254)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172527.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216929 CACGAAGACTCCTTGATTAAA pLKO.1 927 CDS 100% 15.000 21.000 N Nudt15 n/a
2 TRCN0000178335 GAGCAAGGTTATGACCCATTT pLKO.1 853 CDS 100% 10.800 15.120 N Nudt15 n/a
3 TRCN0000439675 ACCTTGAAAGGACCACGAAGA pLKO_005 914 CDS 100% 4.050 5.670 N Nudt15 n/a
4 TRCN0000181733 GCTTTGCCTCCGTGGTAAATT pLKO.1 653 CDS 100% 15.000 12.000 N Nudt15 n/a
5 TRCN0000414506 TGCATGGAGGCGAGCGTAATA pLKO_005 1169 3UTR 100% 13.200 10.560 N Nudt15 n/a
6 TRCN0000426521 ACCCATTTAAAGAGGACCTGA pLKO_005 866 CDS 100% 2.640 2.112 N Nudt15 n/a
7 TRCN0000197464 CATATTAATGAAAGGAGAGGT pLKO.1 708 CDS 100% 2.640 2.112 N Nudt15 n/a
8 TRCN0000429069 TAAGGAGCTTGCAGTTCATTA pLKO_005 1117 3UTR 100% 13.200 9.240 N Nudt15 n/a
9 TRCN0000198838 CGAGGAATATGGAGCCTGAAA pLKO.1 752 CDS 100% 4.950 3.465 N Nudt15 n/a
10 TRCN0000178149 GAGGTGGATATGACTCATGAT pLKO.1 724 CDS 100% 4.950 3.465 N Nudt15 n/a
11 TRCN0000177417 GTTGAGAAGGAGAATTACCAT pLKO.1 679 CDS 100% 3.000 2.100 N Nudt15 n/a
12 TRCN0000176847 GAGAAGGAGAATTACCATTAT pLKO.1 682 CDS 100% 13.200 7.920 N Nudt15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172527.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08501 pDONR223 100% 80.3% 85.3% None (many diffs) n/a
2 ccsbBroad304_08501 pLX_304 0% 80.3% 85.3% V5 (many diffs) n/a
3 TRCN0000479998 ATACATACCTCCAAATAACTCGAT pLX_317 73.9% 80.3% 85.3% V5 (many diffs) n/a
Download CSV