Transcript: Mouse NM_172595.4

Mus musculus ADP-ribosylation factor-like 15 (Arl15), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Arl15 (218639)
Length:
3376
CDS:
142..756

Additional Resources:

NCBI RefSeq record:
NM_172595.4
NBCI Gene record:
Arl15 (218639)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172595.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062313 CGCTCAGTACAAGAGATCAAA pLKO.1 589 CDS 100% 5.625 7.875 N ARL15 n/a
2 TRCN0000105927 CGCTACTACCAAGGATCTCAA pLKO.1 424 CDS 100% 4.950 3.960 N Arl15 n/a
3 TRCN0000379502 AGCTGACAATATCCGGAAATA pLKO_005 396 CDS 100% 13.200 9.240 N Arl15 n/a
4 TRCN0000382496 AGCTTCTCCCAGCTCATAAAC pLKO_005 697 CDS 100% 13.200 9.240 N Arl15 n/a
5 TRCN0000380119 GTGGATTATCATCGGCATTAA pLKO_005 917 3UTR 100% 13.200 9.240 N Arl15 n/a
6 TRCN0000381811 CCTCTTCAGAGGATGACTTAG pLKO_005 470 CDS 100% 10.800 7.560 N Arl15 n/a
7 TRCN0000105928 TCTTCAGAGGATGACTTAGAA pLKO.1 472 CDS 100% 5.625 3.938 N Arl15 n/a
8 TRCN0000105926 GCCCTGAATATGACTTGGTTT pLKO.1 230 CDS 100% 4.950 3.465 N Arl15 n/a
9 TRCN0000105929 GCTCATAAACTTGTTAGAAGA pLKO.1 708 CDS 100% 4.950 3.465 N Arl15 n/a
10 TRCN0000105925 CGCCATTGATATTTCCGTGAT pLKO.1 1171 3UTR 100% 4.050 2.835 N Arl15 n/a
11 TRCN0000062317 CCGGAAATACTGGAGCCGCTA pLKO.1 408 CDS 100% 0.720 0.504 N ARL15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172595.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08397 pDONR223 100% 90.5% 97% None (many diffs) n/a
2 ccsbBroad304_08397 pLX_304 0% 90.5% 97% V5 (many diffs) n/a
3 TRCN0000474923 TTTTATCTCCATCATCTCCCATAT pLX_317 54.7% 90.5% 97% V5 (many diffs) n/a
Download CSV