Transcript: Mouse NM_172697.3

Mus musculus PRP38 pre-mRNA processing factor 38 (yeast) domain containing A (Prpf38a), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Prpf38a (230596)
Length:
1519
CDS:
223..1161

Additional Resources:

NCBI RefSeq record:
NM_172697.3
NBCI Gene record:
Prpf38a (230596)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123762 GACGCGAATCTATGAATCAAA pLKO.1 300 CDS 100% 5.625 7.875 N Prpf38a n/a
2 TRCN0000305402 AGAGAGTCTGTGATATCATTT pLKO_005 686 CDS 100% 13.200 10.560 N Prpf38a n/a
3 TRCN0000123763 TGCATGTAGATGAGTTCATTT pLKO.1 647 CDS 100% 13.200 9.240 N Prpf38a n/a
4 TRCN0000305401 ATCAAGAGCCAGAACCGAAAT pLKO_005 610 CDS 100% 10.800 7.560 N Prpf38a n/a
5 TRCN0000305339 CACAGGAACTGCAATTGATTG pLKO_005 549 CDS 100% 10.800 7.560 N Prpf38a n/a
6 TRCN0000123761 GCGAATCTATGAATCAAAGTA pLKO.1 303 CDS 100% 5.625 3.938 N Prpf38a n/a
7 TRCN0000123760 GCCACTCAAAGTCTCCTGAAA pLKO.1 1097 CDS 100% 4.950 3.465 N Prpf38a n/a
8 TRCN0000309577 GCCACTCAAAGTCTCCTGAAA pLKO_005 1097 CDS 100% 4.950 3.465 N Prpf38a n/a
9 TRCN0000123759 GCATCTTGACTTTGGTCCAAA pLKO.1 1167 3UTR 100% 4.950 2.970 N Prpf38a n/a
10 TRCN0000309576 GCATCTTGACTTTGGTCCAAA pLKO_005 1167 3UTR 100% 4.950 2.970 N Prpf38a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12891 pDONR223 100% 33.8% 39.7% None (many diffs) n/a
2 ccsbBroad304_12891 pLX_304 0% 33.8% 39.7% V5 (many diffs) n/a
3 TRCN0000474515 TATCTTCCGATGTCTTGCTAACTC pLX_317 100% 33.8% 39.7% V5 (many diffs) n/a
Download CSV