Transcript: Mouse NM_172740.2

Mus musculus zinc finger protein 420 (Zfp420), mRNA.

Source:
NCBI, updated 2017-05-11
Taxon:
Mus musculus (mouse)
Gene:
Zfp420 (233058)
Length:
3334
CDS:
389..2125

Additional Resources:

NCBI RefSeq record:
NM_172740.2
NBCI Gene record:
Zfp420 (233058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172740.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095152 AGAGGGTTCATACTAACGAAA pLKO.1 1203 CDS 100% 4.950 6.930 N Zfp420 n/a
2 TRCN0000095151 GAATGCCGAATAGACTTTAAT pLKO.1 2081 CDS 100% 15.000 10.500 N Zfp420 n/a
3 TRCN0000095149 GCTGTGATATAGAAGGTCTTT pLKO.1 2341 3UTR 100% 4.950 3.465 N Zfp420 n/a
4 TRCN0000095153 GAATTCATATCCGTGGCAAAT pLKO.1 2046 CDS 100% 0.000 0.000 N Zfp420 n/a
5 TRCN0000095150 GCACGTGGATTGTTGCTCATA pLKO.1 1679 CDS 100% 4.950 2.970 N Zfp420 n/a
6 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1803 CDS 100% 5.625 2.813 Y ZNF345 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172740.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05004 pDONR223 100% 71.5% 76.3% None (many diffs) n/a
2 ccsbBroad304_05004 pLX_304 0% 71.5% 76.3% V5 (many diffs) n/a
3 TRCN0000479330 AGCGGACCGAGCAAAGCTACTGGT pLX_317 23.2% 71.5% 76.3% V5 (many diffs) n/a
Download CSV