Transcript: Mouse NM_172803.2

Mus musculus dedicator of cytokinesis 4 (Dock4), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Dock4 (238130)
Length:
8072
CDS:
306..6242

Additional Resources:

NCBI RefSeq record:
NM_172803.2
NBCI Gene record:
Dock4 (238130)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105910 CGCCAGATGTTACATGAAATA pLKO.1 6417 3UTR 100% 13.200 10.560 N Dock4 n/a
2 TRCN0000105914 CCGCTACATCCACAAACTCTA pLKO.1 3932 CDS 100% 4.950 3.960 N Dock4 n/a
3 TRCN0000105913 CGACTGATGGAACATCGACAT pLKO.1 849 CDS 100% 4.050 3.240 N Dock4 n/a
4 TRCN0000105912 CCGTAAGGTGTCTCAGCTATA pLKO.1 6221 CDS 100% 10.800 7.560 N Dock4 n/a
5 TRCN0000105911 GCCTACACTCTCCTGTTGTAT pLKO.1 3990 CDS 100% 5.625 3.938 N Dock4 n/a
6 TRCN0000009880 GATACCTACGGAGCACGAGAA pLKO.1 311 CDS 100% 4.050 2.835 N DOCK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172803.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11410 pDONR223 100% 50.3% 53.4% None (many diffs) n/a
2 ccsbBroad304_11410 pLX_304 0% 50.3% 53.4% V5 (many diffs) n/a
3 TRCN0000480447 AGACCCGTCTGTCAAACGTTTCAC pLX_317 7.5% 50.3% 53.4% V5 (many diffs) n/a
Download CSV