Transcript: Mouse NM_172890.3

Mus musculus solute carrier family 6 (neurotransmitter transporter, GABA), member 11 (Slc6a11), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc6a11 (243616)
Length:
4066
CDS:
37..1920

Additional Resources:

NCBI RefSeq record:
NM_172890.3
NBCI Gene record:
Slc6a11 (243616)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172890.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079540 CTTGGCTATATCCGATGGCAT pLKO.1 654 CDS 100% 2.640 3.696 N Slc6a11 n/a
2 TRCN0000079539 GCCCGAGAAATTACAGAAGTT pLKO.1 1761 CDS 100% 4.950 3.465 N Slc6a11 n/a
3 TRCN0000079541 CGTGGTAGACATGTACCCTAA pLKO.1 1284 CDS 100% 4.050 2.835 N Slc6a11 n/a
4 TRCN0000079538 CCAGGATCTATGGCTTAGGAT pLKO.1 2876 3UTR 100% 3.000 2.100 N Slc6a11 n/a
5 TRCN0000079542 CTGCCCTTTATTTGAAGGCAT pLKO.1 396 CDS 100% 2.640 1.848 N Slc6a11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172890.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11136 pDONR223 100% 28.4% 30.2% None (many diffs) n/a
2 ccsbBroad304_11136 pLX_304 0% 28.4% 30.2% V5 (many diffs) n/a
3 TRCN0000473624 ATTCTTAGGCATGTTGATGCACAT pLX_317 22.1% 28.4% 30.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV