Transcript: Mouse NM_172932.4

Mus musculus neuroligin 3 (Nlgn3), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Nlgn3 (245537)
Length:
3899
CDS:
318..2795

Additional Resources:

NCBI RefSeq record:
NM_172932.4
NBCI Gene record:
Nlgn3 (245537)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172932.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438123 GGCGAGGACTTAGCGGATAAT pLKO_005 786 CDS 100% 13.200 18.480 N NLGN3 n/a
2 TRCN0000031940 CCATCACTATGATTCCTAATT pLKO.1 2677 CDS 100% 13.200 9.240 N Nlgn3 n/a
3 TRCN0000031943 CCTCCTGTTTCTCAATGTGTT pLKO.1 2399 CDS 100% 4.950 3.465 N Nlgn3 n/a
4 TRCN0000031942 GAGCTGGTAGAACAGGACATT pLKO.1 1323 CDS 100% 4.950 3.465 N Nlgn3 n/a
5 TRCN0000031941 GTGGACAATCTGTATGGCTAT pLKO.1 1557 CDS 100% 4.050 2.835 N Nlgn3 n/a
6 TRCN0000031939 CCACTGAATTAAGTGTCACTA pLKO.1 2362 CDS 100% 4.950 2.970 N Nlgn3 n/a
7 TRCN0000047083 GCAGACAAAGTGGGCTGTAAT pLKO.1 1251 CDS 100% 13.200 9.240 N NLGN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172932.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08371 pDONR223 100% 92.7% 98.1% None (many diffs) n/a
2 ccsbBroad304_08371 pLX_304 0% 92.7% 98.1% V5 (many diffs) n/a
3 TRCN0000478917 ATAACAACAGCAGAAGTCTCTGCG pLX_317 12.4% 92.7% 98.1% V5 (many diffs) n/a
Download CSV