Transcript: Mouse NM_172974.2

Mus musculus COP9 signalosome subunit 7B (Cops7b), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cops7b (26895)
Length:
2231
CDS:
153..947

Additional Resources:

NCBI RefSeq record:
NM_172974.2
NBCI Gene record:
Cops7b (26895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172974.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374705 ACCTCTTGGAGCAGTTCATTT pLKO_005 181 CDS 100% 13.200 18.480 N Cops7b n/a
2 TRCN0000120899 CGAGGTTAGCAACATTAAGAA pLKO.1 785 CDS 100% 5.625 7.875 N Cops7b n/a
3 TRCN0000120898 CCCGGATTACATAGCCAACAA pLKO.1 377 CDS 100% 4.950 6.930 N Cops7b n/a
4 TRCN0000336383 CCCGGATTACATAGCCAACAA pLKO_005 377 CDS 100% 4.950 6.930 N Cops7b n/a
5 TRCN0000120897 GCTCAATGGATGCCATCGTAA pLKO.1 1150 3UTR 100% 4.950 6.930 N Cops7b n/a
6 TRCN0000120900 CCTATGGTACATACCCGGATT pLKO.1 364 CDS 100% 4.050 5.670 N Cops7b n/a
7 TRCN0000336384 GGAGCTAATGCTGCGTATTTG pLKO_005 324 CDS 100% 13.200 9.240 N Cops7b n/a
8 TRCN0000336386 TCCGGAAGAAAGATATCAATA pLKO_005 637 CDS 100% 13.200 9.240 N Cops7b n/a
9 TRCN0000374706 AGGGAACTAGAAGACCTTATC pLKO_005 528 CDS 100% 10.800 7.560 N Cops7b n/a
10 TRCN0000336385 CCTAAGCTGGAGGCAGTTTAC pLKO_005 1274 3UTR 100% 10.800 7.560 N Cops7b n/a
11 TRCN0000118155 CCTTATCATTGAGGCTGTCTA pLKO.1 542 CDS 100% 4.950 3.465 N COPS7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172974.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12478 pDONR223 100% 55.3% 58.3% None (many diffs) n/a
2 ccsbBroad304_12478 pLX_304 0% 55.3% 58.3% V5 (many diffs) n/a
3 TRCN0000467104 CGGTGCTGTTCTCGTATACTCTGA pLX_317 59.6% 55.3% 58.3% V5 (many diffs) n/a
Download CSV