Transcript: Mouse NM_172993.3

Mus musculus zinc finger protein 512 (Zfp512), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Zfp512 (269639)
Length:
3317
CDS:
113..1801

Additional Resources:

NCBI RefSeq record:
NM_172993.3
NBCI Gene record:
Zfp512 (269639)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_172993.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173992 GCACAAGTGGAAGACGGATAT pLKO.1 1297 CDS 100% 10.800 15.120 N Zfp512 n/a
2 TRCN0000173169 CAAGTGGAAGACGGATATCAA pLKO.1 1300 CDS 100% 5.625 7.875 N Zfp512 n/a
3 TRCN0000193458 GTACTTAGAGATCATGGATAA pLKO.1 598 CDS 100% 10.800 8.640 N Zfp512 n/a
4 TRCN0000193409 CCTTCTGTGTTTGTTACATAA pLKO.1 2224 3UTR 100% 13.200 9.240 N Zfp512 n/a
5 TRCN0000137601 CGTTCTGCCAAGATAGCTGTA pLKO.1 1139 CDS 100% 4.050 2.835 N ZNF512 n/a
6 TRCN0000285460 CGTTCTGCCAAGATAGCTGTA pLKO_005 1139 CDS 100% 4.050 2.835 N ZNF512 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_172993.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12820 pDONR223 100% 72.8% 74.3% None (many diffs) n/a
2 ccsbBroad304_12820 pLX_304 0% 72.8% 74.3% V5 (many diffs) n/a
3 TRCN0000472898 ATGTCTGTTTATCCGTCTGGCGGC pLX_317 18.6% 72.8% 74.3% V5 (many diffs) n/a
Download CSV