Transcript: Human NM_173197.2

Homo sapiens potassium voltage-gated channel interacting protein 2 (KCNIP2), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-05-28
Taxon:
Homo sapiens (human)
Gene:
KCNIP2 (30819)
Length:
907
CDS:
353..907

Additional Resources:

NCBI RefSeq record:
NM_173197.2
NBCI Gene record:
KCNIP2 (30819)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173197.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044354 GCGTGGACGATGAATTTGAAT pLKO.1 429 CDS 100% 5.625 4.500 N KCNIP2 n/a
2 TRCN0000044356 CGGAATTGTCAATGAGGAGAA pLKO.1 562 CDS 100% 4.050 2.835 N KCNIP2 n/a
3 TRCN0000044353 GCAGATTTACTCCCAGTTCTT pLKO.1 589 CDS 100% 4.950 2.970 N KCNIP2 n/a
4 TRCN0000069761 GCCTTTGACACCAACCATGAT pLKO.1 653 CDS 100% 4.950 2.970 N Kcnip2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173197.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03136 pDONR223 100% 68.2% 66% None (many diffs) n/a
2 ccsbBroad304_03136 pLX_304 0% 68.2% 66% V5 (many diffs) n/a
3 TRCN0000472305 TCCACACCAAATTTCAATAGGCGC pLX_317 63.9% 68.2% 66% V5 (many diffs) n/a
Download CSV