Transcript: Mouse NM_173414.3

Mus musculus LanC lantibiotic synthetase component C-like 3 (bacterial) (Lancl3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lancl3 (236285)
Length:
3920
CDS:
258..1520

Additional Resources:

NCBI RefSeq record:
NM_173414.3
NBCI Gene record:
Lancl3 (236285)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_173414.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126844 GCTCCATTTCATCCTATTATA pLKO.1 2663 3UTR 100% 15.000 10.500 N Lancl3 n/a
2 TRCN0000126847 CCCAAAGGTTTGCTCAGTTCT pLKO.1 1354 CDS 100% 4.950 3.465 N Lancl3 n/a
3 TRCN0000126845 CCCAACACAAATTAAAGCAAT pLKO.1 839 CDS 100% 4.950 3.465 N Lancl3 n/a
4 TRCN0000126848 GTTTGCTTTCTCATTGATCTA pLKO.1 1452 CDS 100% 4.950 3.465 N Lancl3 n/a
5 TRCN0000126846 GCTCAGTTCTTATTCACTGAA pLKO.1 1365 CDS 100% 0.495 0.347 N Lancl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173414.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05507 pDONR223 100% 81.1% 82% None (many diffs) n/a
2 ccsbBroad304_05507 pLX_304 0% 81.1% 82% V5 (many diffs) n/a
3 TRCN0000476090 TCTAAAATAAGAAGAACCCTAGTG pLX_317 28.8% 81.1% 82% V5 (many diffs) n/a
Download CSV