Transcript: Human NM_173493.3

Homo sapiens PAS domain containing repressor 1 (PASD1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PASD1 (139135)
Length:
3110
CDS:
193..2514

Additional Resources:

NCBI RefSeq record:
NM_173493.3
NBCI Gene record:
PASD1 (139135)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173493.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107881 GCCATTGATAGATACCTCAAA pLKO.1 2151 CDS 100% 4.950 6.930 N PASD1 n/a
2 TRCN0000107882 CCAAACACATTACGCCACGTT pLKO.1 1429 CDS 100% 2.640 3.696 N PASD1 n/a
3 TRCN0000107884 GCCTGAGGTGAATCCATTGTA pLKO.1 1062 CDS 100% 5.625 3.938 N PASD1 n/a
4 TRCN0000107880 GCTTTGCATATCCATGTTCTA pLKO.1 2793 3UTR 100% 4.950 3.465 N PASD1 n/a
5 TRCN0000107883 GCTACAGTTATTAGATGGCTT pLKO.1 303 CDS 100% 2.640 1.848 N PASD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173493.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09578 pDONR223 100% 99.9% 100% None 33A>G n/a
2 ccsbBroad304_09578 pLX_304 29.2% 99.9% 100% V5 33A>G n/a
3 TRCN0000467332 CCTTACGGAAGTATAAACTGTTTT pLX_317 17.3% 99.9% 100% V5 33A>G n/a
Download CSV