Transcript: Human NM_173505.4

Homo sapiens ankyrin repeat domain 29 (ANKRD29), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ANKRD29 (147463)
Length:
3387
CDS:
182..1087

Additional Resources:

NCBI RefSeq record:
NM_173505.4
NBCI Gene record:
ANKRD29 (147463)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173505.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285001 ACGATGGCACAACAGCATTAT pLKO_005 807 CDS 100% 13.200 18.480 N ANKRD29 n/a
2 TRCN0000005436 GTCAGGTACAACTGCCCTATT pLKO.1 412 CDS 100% 10.800 15.120 N ANKRD29 n/a
3 TRCN0000005433 GCTCTATTGTTGGGAATCTAT pLKO.1 1884 3UTR 100% 5.625 7.875 N ANKRD29 n/a
4 TRCN0000273505 TACTTGGATGTTATTCGATTA pLKO_005 650 CDS 100% 10.800 8.640 N ANKRD29 n/a
5 TRCN0000273558 AGCTAACTTAGCTCCATATTT pLKO_005 1082 CDS 100% 15.000 10.500 N ANKRD29 n/a
6 TRCN0000273560 TGTATGTCATTCCAGTATAAA pLKO_005 1559 3UTR 100% 15.000 10.500 N ANKRD29 n/a
7 TRCN0000005437 CAAAGGGTATAATGATGTCAT pLKO.1 841 CDS 100% 4.950 3.465 N ANKRD29 n/a
8 TRCN0000005434 GCCATAATGATGTCGTGAGAT pLKO.1 450 CDS 100% 4.950 3.465 N ANKRD29 n/a
9 TRCN0000005435 TCCCTGAGAAACAAGGCCAAT pLKO.1 989 CDS 100% 4.050 2.835 N ANKRD29 n/a
10 TRCN0000273559 TCCCTGAGAAACAAGGCCAAT pLKO_005 989 CDS 100% 4.050 2.835 N ANKRD29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173505.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09647 pDONR223 100% 99.7% 99.6% None 335G>A;903C>T n/a
2 ccsbBroad304_09647 pLX_304 0% 99.7% 99.6% V5 335G>A;903C>T n/a
3 TRCN0000470863 CACTCTGCGTTCGAGAACACGTGC pLX_317 49% 99.7% 99.6% V5 335G>A;903C>T n/a
Download CSV