Transcript: Human NM_173508.4

Homo sapiens solute carrier family 35 member F3 (SLC35F3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SLC35F3 (148641)
Length:
3143
CDS:
403..1875

Additional Resources:

NCBI RefSeq record:
NM_173508.4
NBCI Gene record:
SLC35F3 (148641)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_173508.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241559 CGGTAAGTTCTATGGTATTTA pLKO_005 1980 3UTR 100% 15.000 21.000 N SLC35F3 n/a
2 TRCN0000241557 GTTTGGAGAAGCCGCCTTATT pLKO_005 1389 CDS 100% 13.200 18.480 N SLC35F3 n/a
3 TRCN0000241556 TTTGGAATTGCCGTTACATAT pLKO_005 1570 CDS 100% 13.200 18.480 N SLC35F3 n/a
4 TRCN0000044833 GCGATTAAGGAGGATCTGAAA pLKO.1 547 CDS 100% 4.950 3.960 N SLC35F3 n/a
5 TRCN0000245407 TACAGGGAATGCTGTCGATTT pLKO_005 1006 CDS 100% 10.800 7.560 N SLC35F3 n/a
6 TRCN0000241558 TGCGCATCACTGGCTACTATG pLKO_005 635 CDS 100% 10.800 7.560 N SLC35F3 n/a
7 TRCN0000044836 CATTCCTATTATCCTCTACTT pLKO.1 1452 CDS 100% 4.950 3.465 N SLC35F3 n/a
8 TRCN0000044837 CGTCTGCAAGTCCACAGAGAA pLKO.1 966 CDS 100% 4.950 3.465 N SLC35F3 n/a
9 TRCN0000044835 CCACTCTGATGTCTCTTGGAA pLKO.1 1592 CDS 100% 3.000 2.100 N SLC35F3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_173508.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000481608 GTGAGTGGACTAAGCCAATCTCCT pLX_317 32.8% 83.6% 81.2% V5 (many diffs) n/a
2 ccsbBroadEn_14403 pDONR223 100% 83.5% 81% None (many diffs) n/a
3 ccsbBroad304_14403 pLX_304 0% 83.5% 81% V5 (many diffs) n/a
Download CSV